|
1. Sector : Power Plant
Annual maintenance contract / rutine maintenance contract of electro mechanical equipments installed - manager (be/b tech in electrical engineering), engineer (b.e/b.tech/ diploma( electrical)), electrical supervisor (diploma holder in electrical engineering), electrician highly skilled, welder cum grinder, mechanic/fitter highly skilled, electric crane operator, helper skilled, cook, mess helper & tea boy, sweeper/floor cleaner, other misc expenses for annual maintenance such as hiring charges of vehicles incl pol, office maintenance ,insurance of manpower ,mobilization charges extra(for 3 units,17 months), consumables, tools tackles and welding material & other misc. items to be provided by the contractor (for routine maintenance)for two years, cotton waste, m-seal (100 gm pack), teflon tape, champion 3/4" ” x 12 m, fevi quick 2 gm, hexa blade 1 ” x12 ”, diesel, petrol, m.t.o, malmal cloth, markin cloth, duster cloth, rust remover, emery cloth tape 150 mmx50mtr. coarse p120, led bulb 14w, holder screw type, 250w, socket(16a); top(16a); switch(16a), halogen tube 1000 watts, loctite 406 (20gram), loctite 243 (250ml), cotton hand gloves, marker pens, crc 226 (500ml), crc-co contact cleaner (400ml), pvc tape/insulation tape, collin spray (500ml), detergent cakes (250gm), dettol-handwash (250ml), mcb spn/dpn 16a,32a, single core wire 4mm 2, 4-core cable 2.5 mm2, 2-core cable 4 mm 2, led screw type 7w, 9w, hand torchs rechargable, power hexa blades, thinner ici, mp grease/ lithium based oil grease, rccb, 63a, tpn, voltage transducer e15-3a1eedo rmax 750 ohms i/p 0-110v o/p 4-20 ma, current transducer e15-3a13edo rmax- 75ohms i/p 0-5a; ctr-1000/5a o/p 4-20 ma, blower, tarpaulene & plastics, floor wiper, dusting wiper, a4 size paper rim, writing pen, toilet cleaner, led tube rod 18w, anabond 666 silicone rtv, tap sets 4mm to 16mm, measurement tapes 5 mts, clamp meter digital 0 to 1000 a ac/dc, smps, 450w, rubber hose ¾ ”, rubber hose 1 ”, floor cleaner, 8 meter ladder (foldable), welding holder, 600a, welding helmets, welding glass black, welding glass white, welding hand gloves, welding electrode cast iron, welding apron, leg & arm guards, wire brush, chipping hammer, welding hand gloves, welding electrode 3.15mm (ms), welding electrode 4.00mm (ms), vernier calliper digital 150 mm,600 mm, d-spanner ring 6mm to 46mm, ring-spanner ring 6mm to 46mm, eye bolt ss m12, m16, m24, d shackle 2ton to 6 ton, ratchet socket, triffer 5 ton (chain block), hydraulic jack 25 tons, ball pin hammer, sledge hammer, screw driver bit set (42 bits set), nylon sling 2tons, 2mtrs, digital multimeter, hd vacuum cleaner, industrail type, heavy duty)current type (ph/v/hz) -3 / 400 / 50 air flow rate (l/s/m³/h)- 68 / 244.8 vacuum (mbar/kpa)- 286 / 28.6 container capacity (l) -60 rated input power / amps (kw) max. -3.5 filter area (m²) -2.3, hose cutter, dial gauge with stand 0.01mm accuracy, allen key set 2-16 (ss), allen key set 17, 19, 22 & 24 (ss), dial guage with stand 0.01mm accuracy class withstand, pipe wrench, insulation tester with range of test voltage specified ieee 43-2000 and safety rating cat iv-600v, offset slogging spanner 30,32,34,36,42 mm, square scrapers for bearing, inside micrometer 25mm to 1 mt (accuracy class .01mm), outside micrometer 0 to 25mm (accuracy class .01mm), outside micrometer 0 to 150mm (accuracy class .01mm), outside micrometer upto 600mm (accuracy class .01mm), slip guage (accuracy class .01mm), square block level( 0.02mm accuracy class), vernier calliper upto 150mm, vernier calliper upto 600mm, at 450 mw (3x150) bhep stage i
|
Value :
INR 4.01 Cr
*
|
INR 40.10 Mn
*
|
Due Date :
13 Days to go
|
03-02-2020
|
|
TID :38294848
Jammu-kashmir
|
|
|
|
2. Sector : Health Services/Equipments
Supply of chemical and reagents for microbiology lab rate contract for 02 years - oxalic acid (powder) (500 gm), sodium hypochlorite (liquid 10%) solution (35 lt), acetone (500 ml), liquid ammonia (500 ml), absolute alcohol (500 ml), ammonium sulphate (500 gm), glacial acetic acid (500 ml), urea powder (500 gm), paradimethyl amino benzaldehyde (100 gm), ammonium oxalate crystals (500 gm), actidione (1 gm), phenyl crystal (500 gm), ferric ammonium sulphate (100 gm), di sodium hydrogen phosphate (na2hpo4) (100 gm), sodium hydrogen phosphate (nah2po4) (100 gm), sulphuric acid conc. (5 lt), nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) (5 gm), basic carbolfuschin powder (practical grade) (100 gm), barium chloride (100 gm), glycerol (500 ml), glucose anhydrous (500 gm), iso amyl alcohol (500 ml), malachite green (practical grade) (100 gm), sodium nitrite (100 gm), sulphanililc acid (100 gm), toluidine blue (100 gm), magnesium sulphate (mgso4.7h2o) (100 gm), n-acetyl l-cystine (25 gm), formaldehyde solution 40 % (5 lt), nigrocin (himedia) (100 gm), koh pallets (500 gm), naoh pallets (500 gm), concentrated hcl (500 ml), albert’s stain a and b for diphtheria (staining solution) (100 ml), brilliant cresyl blue (100 ml), liquid paraffin (500 ml), sodium acetate (500 gm), sodium sulphite (500 gm), sodium carbonate (500 gm), potassium bromide (500 gm), sodium thiosulphate (500 gm), spirit (500ml), poly vinyl alcohol (250ml), ammonium chloride (500 gm), sodium meta bisulphite (500 gm), sodium bicarbonate extra pure (500 gm), crystal violet (practical grade) (100 gm), bromothymol blue powder (25 gm), cetylpyridinium chloride (100 gm), alpha- naphthylamine (100 gm), sodium deoxycholate (100 gm), magnesium citrate (500 gm), asparagine (5 gm), sodium citrate (500 gm), lactophenol(cotton blue) (100 ml), omera reagent/ v-p reagent (100 ml), potassium tellurite (25 gm), ferric chloride (500 gm), cyanogen bromide (100 gm), andrade’s indicator (125 ml), dimethyl sulphoxide (dmso) (500 ml), iodine crystal (500 gm), potassium idodide (250 gm), safarnine (100 gm), neutral red (100 gm), dpx mount (250 ml), paradimethylaminocinnamaldehyde (100 gm), hydrogen peroxide (h2o2) (100 ml), alpha – naphthalamine (100 gm), sodium hippurate (100 gm), alpha – naphthol (100 gm), creatinine (100 gm), l – pyrolidonyl b – nephthalamide (50 gm), gelatin (500 gm), sodium borohydrate (100 gm), cobalt chloride (100 gm), agarrose with high eeo (100 gm), dextrose anhydrous (500 gm), lactose (500 gm), maltose (500 gm), mannitol (500 gm), dulcitol (500 gm), sucrose (500 gm), xylose (500 gm), arabinose (500 gm), sorbitol (500 gm), schaudinn's solution (250 ml), microsporidiatrichome blue stain (250 ml), merthiolate iodine formalin (250 ml), chloroform (500 ml), formamide (500 ml), methylene blue (25 gm), nonidet p-40 (100 ml), phosphoric acid (500 ml), potassium di hydrogen phosphate (500 gm), potassium permanganate (500 gm), isopropanol (500 ml), sodium bicarbonate (500 gm), giemsa stain solutoin (1 kit), disposable syringe 5ml with needle, disposable syringe 10ml with needle, disposable syringe 20ml with needle, disposable syringe 50 ml with needle, measuring cylinder 50 ml plastic, measuring cylinder 100 ml plastic, measuring cylinder 500 ml plastic, measuring cylinder 1000 ml plastic, test tube racks 48 holes for 12 mm test tubes, test tube racks 48 holes for 15 mm test tubes, nitril gloves medium size 6.5 each, nitril gloves small size 6.5 each, latex gloves 6.5” unsterilized (pack of 100 pc.) , latex gloves 7.5” unsterilized (pack of 100 pc.) , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle- 125 ml, plastic dropping bottles- 500 ml, sterile disposable petri dish- 90mm, disposable container for urine sample/sputum for c/s sterile(individually packed), disposable plastic test tubes 75 x12 mm, beaker plastic various size- 50 ml., beaker plastic various size- 100 ml., beaker plastic various size- 250 ml., beaker plastic various size- 500 ml ., beaker plastic various size- 1000 ml., thumb press disposable dropper, screw cap plastic vial 3 ml disposable with label self standing, autoclavable tubes (pw-1162) 150 x 18 mm diameter, vacutainer (5 ml without edta), autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , . sterile cotton swab (in screw caped polythen tube with coated with polytropylen stick size 75x12mm, 150x12mm.), wash bottle (100 ml), microslide 75 x25 x1.25 mm to 1.5 mm (glass), beaker 50 ml glass borosil (cornig) , beaker 100 ml glass borosil (cornig) , beaker 250 ml glass borosil (cornig) , beaker 500 ml glass borosil (cornig) , beaker 1000 ml glass borosil (cornig) , flat bottom conical flask 100 ml borosil (cornig), flat bottom conical flask 200 ml borosil (cornig), flat bottom conical flask 500 ml borosil (cornig), flat bottom conical flask 1000ml borosil (cornig), round flat bottom flask 100 ml borosil (cornig), round fla...
|
Value :
1 Cr
*
|
10 Mn
*
|
Due Date :
1 Day ago
|
20-01-2020
|
|
TID :38010364
Rajasthan
|
|
|
|
3. Sector : Coal and Lignite
Procurement of lhd spares - slip ring (250a00034/001), bronze carbon brush (250a00034/003), insulator (250a00034/005), idler sprocket assy( 250a070000036), chain wheel (1"pitch) (250b060000054), cable reel valve assy. (250c050000011), pressure reducing valve (611a050000004), pilot valve (4 sec) (611b050000107), hyd. fan motor (613a000000332), bush (625a000003260), suction strainer (625b050000122), sprocket (625c000003249), seal (627a00023/003), steering valve (811a070000211), hyd. pump (811b050000101), transmission cable assy. (811b050000122), throttle cable assy. (811b050000123), drive line middle (811b050000128), drive line rear (811b050000130), lift cylinder (811b050000183)/ (811b050000198), steering cylinder (811b050000201), transmission (20000) (811c050000116), spider assy. (811m100000417), spacer (912a060000123), hyd. motor (912b050000121), filter element (eea0003479), insulator (eea0004292), insulator (eea0004294), shaft seal (eea0005646), twin cooler assy.(811c050000102), bearing ret. ring (eea0005764), piston return spring (eea0005783), clutch inner disc (eea0005787), clutch outer disc (eea0005788), outer clutch piston ring (eea0005790), inner clutch piston ring (eea0005791), clutch inner disc (eea0005829), pump assy.conv.hsg gasket (eea0005875), filter assy. (eea0005879), piston ring (eea0008081), piston ring (eea0008224), piston ring (eea0008227), oil seal (eea0009093), check valve (eea0009581), oil seal (eea0010052), oil seal (eea0010843), kit drive plate (eea0010872), clutch piston assy (eea0010878), clutch piston assy (eea0010879), piston clutch assy. (eea0010880), gasket (eea0010883), gasket (eea0010886), seal output saft (eea0010906), seal kit (eea0015034), seal kit (eea0015174), nut (eea0015373), snap ring (eea0015384), o.ring (eea0015389), seal (eea0015404), back up ring (eea0015472), o.ring (eea0015473), bush(mbh150/170/140a), bonded seal (sc011/019), bonded seal (sc011/024), ring piston (eea0010915), pump charging (eea0010924), ring external snap (eea0010954), o.ring flange (eea0010959), flange (5c) (eea0011861), sph. bearing ( stdc003/047), chain 1" (250a050000031), roller(811a050000103), roller(811a050000104), drive line(811b050000136), bush( mbh60/72/50a), o ring( seg1093), oil seal( seg240), lift arm assly.(811a070000460), spherical bearing(stdc003/36), seal kit(eea0020991), seal kit(eea0020978), bush( mbh60/72/80a), seal kit (eea0020994), back up ring(eea0021738), o ring (12wl4189653a), back up ring(12wl4189654a), intermediate brake disc(eea0021744), brake disc(eea0021745), retainer ring (eea0005720), bore plug ret.ring (eea0005759), o.ring (eea0015477), o.ring (eea0015479), slip ring and brush holder assl. (250m000000134), halogen reflector lamp 24v/50w(eea0026326), planet gear(eea0021721), ring gear support(eea0021728), hyd motor(811a050000151), axle bolt (811a060000121) at jk area.
|
Value :
INR 72.33 Lac
*
|
INR 7.23 Mn
*
|
Due Date :
14 Days to go
|
04-02-2020
|
|
TID :38105563
Madhya Pradesh
|
|
|
|
|
5. Sector : Business Consultancy
Supply of materials, g.i pipe (50mm) class b, teak wood , unscaled lime , stone aggregate (40mm) , brick metal (20 to 25mm) , surkhi , gur (jaggrey) , belgiri (aegle marmelos) , urad (black gram) , menthi (fenugreek), sun (jute fiber) , sand stone dust , appoxy reason , colour pigment , stone slab (70mm) , chinkari stone (12mm thick) , sand stone (0.30 x 0.30 x 0.30), nails, screw, hole pass aldorp , coarse sand iind zone , coarse sand iiird zone , port land cement , nylon brush , wire brush , mason karni medium , mason karni small, plastic pan small , narial brush , chisel , enamel paint , metal primer , wax polish , plastic pan big , pick axe big , pick axe small , spades big , spade small , cotton string , sieves big , sieves medium , sieves small , wooden peg , paper bag , cotton bag , pollythin , stone benches , dustbin , braille signage, signage complete.
M.w.(con.) s.r,. to identified monument to group of monument at sanchi, distt. (m.p).
|
Value :
INR 36.55 Lac
*
|
INR 3.65 Mn
*
|
Due Date :
6 Days to go
|
27-01-2020
|
|
TID :38229928
Madhya Pradesh
|
|
|
|
6. Sector : Other Services
Processing of reagents and consumables 4 - test tube rack to accommodate 3 ml. test tubes 5x15, test tube rack to accommodate 5 ml. test tubes 5x15, test tube racks4 x 13, test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes), test tube carrier (stainless steel), v.d.r.l. slides (75mmx50mm 1.45mm), wash bottle plastic with delivery nozzle 200ml, wash bottle plastic with delivery nozzle 60ml, bunsen burner, bacteriological loop holder with loop (ready to use), biological indicator for steam , bowie dicktest pack steam, ice box 5 litres, labels for micro centrifuge tubes white size ½”, metaloops (changeable nichrome loop embedded in brass rod with heat resistant handle with-, a. 2 mm diameter nichrome wire, b. 3 mm diameter nichrome wire, c. 4 mm diameter nichrome wire, metaloops (fixed straight nichrome loop embedded in ss rod with heat resistant handle with-, microtome knife, mops, magnifying glass, big size with handle , mortar - pestle , nichrome loop-4 mm, nichrome loop-2 mm, nichrome loop-1.3 mm, pipette stand( vertical & horizontal) 4/5 pipettes, staining rack. 20 slide capacity., sprit lamp glass/ metal, screwdrivers -multipurpose, silver aluminium foil, surgical knife (big), sterile swab sticks, syringe driven filters ptfe (hydrophilic) pore size 0.22µm, thermometer 37degree c, twine, universal collection vials (urine pot), universal wash reagents 500ml, anti-cd 56, anti-61, anti-cd 68, anti-cd 33, anti-ki 67 (mib), anti neurofilament protein, anti-synaptophysin, anti-gfap, anti-cd 99, anti-cd 31, anti-b hcg, poly-l.lysine, anti-cd 20 (b cells), anti-cd 45 (lca), anti-s 100, anti- desmin, anti-c-erb b-2 (her-l/neu), anti-er, anti-pr, anti-cd 3, anti-cd 20, anti-cd 117, anti-cd 34, anti-cd 30, anti-cyclin d1, anti-cd 15, anti-cd 5, fitc-conjugated rabbit, anti-human iga (alpha chain), fitc-conjugated rabbit, anti-human igg (gamma chain), fitc-conjugated rabbit, anti-human kappa light chain, fitc-conjugated rabbit, anti-human c3c complement, fitc-conjugated rabbit, anti-human igm (mu chain), fitc-conjugated rabbit, anti-human lambda (light chain), ana by hep-2-cell-line substrate(kit with reagents), electrodes for µph system 361, osmium tetroxide, chromium trioxide, zinc chloride, di-sodium hydrogen phosphate anhydrous, di-sodium hydrogen orthophosphate dibasic , sodium dihydrogen orthophosphate monohydrate, sodium borate, alpha napthyl butyrate, anti-cish kits-hpv16/18dna, er/p-r control, anti-melanomal(hmb45), anti myeloperoxidase, anti -nse, anti-plap, anti-bc12 oncoprotein, anti-cytokeratin7, anti-cytokeratin20, anti-brca 1protein, anti-iga, anti-igm, anti-igg, anti-compliment cd3, anti-rb gene protein, anti-p53 protein, anti-wt1 turmor, anti-vimentin (v9), anti-ema(e29), anti-p169ink4), kappa, lamda, eosine spirit soluble, pap pen immuno histochemistry, anti-cd 1a, anti-sma, anti-myogenin, fluorescent bchiff reagent, carmine, acriffarine, cresyl fast blue, luxol fast blue, cresyl violet, epinephrine (3x0.5ml), aggrecetion ristocetion a sulfate (3x0.5ml), a d p(adenosine-5l diphosphate(3x0.5ml), arachidonic acid lyohillzed sodium arachidonate, collagen soluble calfskin(3x0.5ml), vw fator assay ristocetin cofactor (3x0.5ml), test tube( siliconized,flate bottom 7x25x55mm), stri bars plastic coaled micro, cryo glue (tissue embedding medium)for cryostat machine, diposables blades for cryostat machine, silicon tubal ring , laser spectacles, fluid warmer, filter for suction machine( atmos), nibp monitor with integrated cuff arm , serum zinc, copper, ceruloplasmin, ammonia, ammonia, alcohol, d- dimer, anti ds dna, anti sn antibody, vitamin d, vitamin e, ngal, cystatin c, g6 pd, lactate, apo a1, homocysteine, bnp, urinary vma, blood ketones, lip a, ana, anti phospholipid antibody, vitamin c, ena, vitamin k, iodine, apo b, troponin t, ck mb1, ck mb 2, tibc, transferrin, igg, igm, iga, inhibin a, ß trace protein, ßeta 2 microgobulin, alpha 1 antitrypsin, a -1 microglobulin, a-2 macroglobulin, screening kit for inborn error of metabolism, eqas for clinical chemistry,immunoassay, electrolyte, hba1c., tpo (thyroperoxidase) antibody, control for m-band electrophoresis, tnf-a, il-2, procalcitonin, 5'acagcgtcatggcagagcaggtggc3’, 5'aaaagctcttcccgcaggatcccgc3’, 5'gtggctgttccgggatggccttctg3’, 5'cttgaagaagggctcactctgtttg3’, 5'cagtacgatgatgcagc3’, 5'caggtagaagaggcggt3’, amikacin ,neomycin &, tobramycin standard (hplc grade), edta gel (15%), acrylic - heat cure-clear, acrylic - heat cure-pink, acrylic - self cure-clear, acrylic - self cure-pink, agate spatula, alginate impression material ( dustless), articulation paper, bur - airotor-diamond, bur - airotor-tc- straight fissure, calcium hydroxide paste for root canal , dappen dish, dental floss – waxed, 25 m, dental stone, dentin bonding agent, die stone, disposable suction tips with copper wire, emery sheet - 100, 150 and 400 grade, endodontic gutta percha points(15-80), etchant gel ( 37 % phosphoric ac...
|
Value :
INR 30 Lac
*
|
INR 3 Mn
*
|
Due Date :
2 Days to go
|
23-01-2020
|
|
TID :37898128
Meghalaya
|
|
|
|
7. Sector : Other Services
Processing of reagents and consumables 4 - mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm dermafilm transparent adhesive dressing, periostal elevators (small and big), winged infusion set- non coring needles with injection site to access ports,20g x 1.00(needle), hickman-double lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(ped), hickman-broviac 4.2fr(or smaller) single lumen pediatric cath w stic papais, hickman-broviac 6.6fr single lumen pediatric cath w stic 90cm, hickman-double lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(adult), plaster cutter electric, plaster saw, plier long nose, pneumatic compression stocking, portable autoclave electrically operated made of aluminium size300mm x 300mm capacity 24 litres, portable autoclave electrically operated made of aluminium size350mm x 300mm-325mm depth 1.5 kw, pyridin, reusable pressure monitoring cable with integrity check system by 100mmhg pressure and with reusable modular clamp, reusable pressure transducer with integrity check system by 100mmhg pressure, with microchip technology, reusable cable, and with reusable clamp, ronguers(down cutter), ronguers(up cutter), rubber macintosh, russian forceps, light weight hernia mesh,pga polypropylene 11 x 15, light weight hernia mesh,pga polypropylene 6 x 11, seldinger technique catheter for arterial puncture content 1 transparent and xpo cathter (pe) /(ptfe) 1 intruducer needle 1 straight wire 115.092 115.094 115.118 5118.702 5118.703 , self holding retractors for spine surgery, single use resuscitation mask for cpcr (non-return valve, integral bacterial/viral filter), slide mailer 1 slide, slide mailer 2 slide, soap dispenser, soda lime (imported) – changes from white to violet on exhaustion 5kg, sodium hypochloride solution 5litre, spreader /plugger , steinman pins4.5mm, steinmann pins, sterigage chemical indicator (for steam) 3m, surgical clipper, surgical preparation razor, thermal videographic printer (black & white) (sony, latest up series), tissue paper for ultrasound, ultra violet cabinet (800/500 x 2000 mm), vacuum assisted dressing system, vascular debeky angle (medium), vascular debeky straight (medium), vaseline gauze, ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for paediatrics, ventilator breathing system with resealable water traps (smooth lumen), waste management wheeled bins. (660lit ; 300lit; 1100 lit), wire cutter , y-pieces for breathing circuit, absorbable gelatin sponge u.s.p (ab-gel) 10 x 10, alginate impression materials(dust free), double swivel with port 15mm, green pvc tubing 6mm for oxygen / per meter , 2 mm osteotomes, 3 mm osteotomes, asepto pump, autoclavable biohazard plastic bag 10liter, autoclavable biohazard plastic bag 20liter, autoclavable biohazard plastic bag 30liter, bone cement(plain), bone cement(antibiotics), bougie(stylet), burretta, capd catheter tenckhoff with 2 felt cuffs sa 1242 (420 mm), cast taper mandrel, chiesel, cleaning brush, cleaning solution, cpr manikin, stoma flatmoldable small 45mm, stoma flatmoldable medium 45mm, stoma flatmoldable regular 57mm, stoma flatmoldable large 70mm, moldable convex 12/22mm, moldable convex 22/33mm, moldable convex 33/57mm, ostomy appliance accessories belt, coloured ph indicator paper, dissecting instrument box, double swivel with port 15 mm x 22mm, drape formers trans femoral, drape formers trans tibial, espocan with docking system, eto chemical indicator tape -3m, eto packing sleeves roll (3m) 12', eto packing sleeves roll (3m) 4', eto packing sleeves roll (3m) 6', surgicel fibrillar 1963, g- bone, gloves wrapper, laparoscopic aspiration needle, hemorrhoids and prolapsed stapler with detachable anvil 3.5mm, hemorrhoids and prolapsed stapler with detachable anvil 4.8mm, hose mount 15mm female male pair, hose mount 22mm female male pair, hygrobaby/hme filter (infant), hygroboy/hme filter (paediatric), hygrostar/hme filter (adult), hygrobac s, intraocular lense 6mm optics foldable, square edge, hydrophobic, intraocular lense rigid 5.25mm optics,pmma, square edge, intraocular lense rigid 5.5mm optics, intraocular lense rigid 5.5mm optics foldable, intraocular lense rigid 6mm optics, intraocular lense rigid 6mm optics foldable, intraocular lense rigid 6mm optics, pmma, square edge, rigid anterior chamber intraocular lens lens power +16d(6.00mm), rigid anterior chamber intraocular lens lens power +19d(6.00mm), rigid anterior chamber intraocular lens lens power +18d(6.00mm), rigid anterior chamber intraocular lens lens power +20d(6.00mm), rigid anterior chamber intraocular lens lens power +21d(6.00mm), rigid ante...
|
Value :
INR 30 Lac
*
|
INR 3 Mn
*
|
Due Date :
2 Days to go
|
23-01-2020
|
|
TID :37898128
Meghalaya
|
|
|
|
8. Sector : Corporations/ Assoc/ Chambers/ Govt Agencies
Purchase of laboratory material - creatinine xl (5x44ml, 5x11ml) kinetic, glucose xl (10x44ml) end point, sgot xl (4x34ml, 4x17ml) kinetic, sgpt xl (4x34ml, 4x17ml) kinetic, triglycerides xl (5x44ml, 5x11ml) end point, urea xl (5x44ml, 5x11ml) kinetic, uric acid xl (5x44ml, 5x11ml) end point, hematology quality controls , calcium xl (10x12ml) end point, multistick (1 pack=100 strip), uristrik (albumin & glucose) (1 pack=100 strips), p.p.d. soln 5 tu (mantoux test)(1 nos.=5ml), xylene (1 nos.=500ml), lens cleaning solution (1 nos.=500ml), capillary for ct (1pack=100tests), e.s.r plastic single use (1 pack=200test) disposable, microscope bulb (6v), dpx (1 nos.=500ml), tsh minividas (1 pack=60 tests), ft3 minividas (1 pack=60 tests), ft4 minividas (1 pack=60 tests), ferritin minividas (1 pack=60 tests), tniu minividas (1 pack=60 tests), ck-mb minividas (1 pack=30 tests), blood glucose auto kit (1 nos.=500ml) god/pod, blood urea auto kit (1 nos.=500ml) kinetic, sgpt auto kit (1 nos.=10ml) kinetic, sgot auto kit (1 nos.=10ml) kinetic, cell pack sysmex xp 100 (1 nos.=20ltr), deionised water (1 nos.=20ltr), edta soln. (1 nos.=500ml), n/10 hclsoln (1 nos.=500ml), strometolysersysmex xp 100 (1 nos.=500ml), auto pipette (5-50 microlitre), auto pipette (200-1000 microlitre), microscope oil - immersion lens, 0.1 n naoh 500ml, eg7+ i-stat, chem 8+ i-stat, pt/inr i-stat, sickling test (solubility based), lugol's iodine (1 nos.=100ml), occult blood test kit (1 pack=25 tests), improved neubauer chamber with cover glass, std a meril electrolyte analyzer (6x250ml), std b meril electrolyte analyzer (2x250ml), reference electrode internal solution meril electrolyte analyzer (1x10ml), qc solution meril electrolyte analyzer (1x110ml), activating solution meril electrolyte analyzer (1x110ml), daily wash solution meril electrolyte analyzer, electrode deproteinization washing solution (1x110ml), electrode internal solution meril electrolyte analyzer (1x3ml), coplin jars, plastic cups small for biochemistry, slide stand, slide staning stand, test tube washing brush, forceps toothed, forceps blunt, slide storage box big, slide storage box small, torniquet belt, rapid pap, slide storing cabinet histopathology, block storing cabinet, scalpel handle 22 no for government hospital.
|
Value :
INR 26.54 Lac
*
|
INR 2.65 Mn
*
|
Due Date :
13 Days to go
|
03-02-2020
|
|
TID :38243410
Gujarat
|
|
|
|
9. Sector : Health Services/Equipments
Purchase of laboratory material like ceatinine, glucose, sgot, sgpt, triglycerides, urea, uric acid, hematology quality, calcium, multistick, uristrik, ppd soln, xylene, lens cleaning, esr plastic, microscope bulb, dpx, tsh minividas, blood glucose auto kit, sgpt auto kit, cell pack sysmex, deionised water, strometolyser sysme, auto pipette, microscope oil, sicklins test, occult blood test kit, coplin jars, slide stand, slide staning stand, test tube washing brush, forceps toothed, torniquet belt, block storing cabinet etc for government hospital 2019-20
|
Value :
INR 26.54 Lac
*
|
INR 2.65 Mn
*
|
Due Date :
13 Days to go
|
03-02-2020
|
|
TID :38242026
Gujarat
|
|
|
|
10. Sector : Security Services
Purchase of expendable medical stores, anti a,b,d blood grouping sera, capillary tube (40 mm), drabkin solution , erba path control, esr pipette - disposable, esr vaccutainer, estimation of widal kit (4x5 ml), hiv i & ii rapid test card (tridot), ketostick (for ketone bodies bott of 100 strips), kit dengue (kit of 10 strips) ns1,igg,igm (j mitra), kit for estimation of triglyceride (5x20) ml (erba), kit for estimation of amylase (6x6) (erba), kit for estimation of aso titre, kit for estimation of c reactive protein (crp), kit for estimation of calcium kit (2x50 ml), kit for estimation of hdl cholesterol 2x50 ml (erba), kit for estimation of serum bilirubin (total+direct) 4x60 ml (erba), kit for estimation of total protein (erba), kit for ra factor 50 test, kits for estimation of albumin (erba), kits for estimation of alkaline phosphatase 5x20 ml (erba), kits for estimation of cholesterol 5x 20 ml (erba), kits for estimation of creatinine 4x 60 ml (erba), kits for estimation of glucose 2x200 ml (erba), kits for estimation of sgot 5x20 ml (erba), kits for estimation of sgpt 5x20 ml (erba), kits for estimation of urea 5x20 ml (erba), kits for estimation of uric acid 5x 20 ml (erba), leishman stain liquid (solution), micro tips for(1-20micro), microscope slide 18 mm (box of 50 slide), microscopic cover glass slip 22x37 mm pkt of 200 gm, microtips small (5-100 lu), paracheck malaria strips, pregnancy card, prothrombin time reagent, rapid card screening for hbsag , rapid card screening for hcv , semi auto analyser wash solution (erba), sodium hypochlorite solution , sprit, strips 'albumin' and glucose bottle of 100 strips , test tube 75 mm x 12mm , test tube rack (plastic) for 60 tubes, torniquet, urine container , vaccutainer edta vaccum with gel , vaccutainer sodium flouride with vaccum with gel , vaccutainer sterile vaccum with gel, vdrl kit 50 strip, washing brush for echs.
|
Value :
INR 25 Lac
*
|
INR 2.50 Mn
*
|
Due Date :
1 Day ago
|
20-01-2020
|
|
TID :38209426
Punjab
|
|
|