Requirement :
|
Processing of reagents and consumables 4 - test tube rack to accommodate 3 ml. test tubes 5x15, test tube rack to accommodate 5 ml. test tubes 5x15, test tube racks4 x 13, test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes), test tube carrier (stainless steel), v.d.r.l. slides (75mmx50mm 1.45mm), wash bottle plastic with delivery nozzle 200ml, wash bottle plastic with delivery nozzle 60ml, bunsen burner, bacteriological loop holder with loop (ready to use), biological indicator for steam , bowie dicktest pack steam, ice box 5 litres, labels for micro centrifuge tubes white size ½”, metaloops (changeable nichrome loop embedded in brass rod with heat resistant handle with-, a. 2 mm diameter nichrome wire, b. 3 mm diameter nichrome wire, c. 4 mm diameter nichrome wire, metaloops (fixed straight nichrome loop embedded in ss rod with heat resistant handle with-, microtome knife, mops, magnifying glass, big size with handle , mortar - pestle , nichrome loop-4 mm, nichrome loop-2 mm, nichrome loop-1.3 mm, pipette stand( vertical & horizontal) 4/5 pipettes, staining rack. 20 slide capacity., sprit lamp glass/ metal, screwdrivers -multipurpose, silver aluminium foil, surgical knife (big), sterile swab sticks, syringe driven filters ptfe (hydrophilic) pore size 0.22µm, thermometer 37degree c, twine, universal collection vials (urine pot), universal wash reagents 500ml, anti-cd 56, anti-61, anti-cd 68, anti-cd 33, anti-ki 67 (mib), anti neurofilament protein, anti-synaptophysin, anti-gfap, anti-cd 99, anti-cd 31, anti-b hcg, poly-l.lysine, anti-cd 20 (b cells), anti-cd 45 (lca), anti-s 100, anti- desmin, anti-c-erb b-2 (her-l/neu), anti-er, anti-pr, anti-cd 3, anti-cd 20, anti-cd 117, anti-cd 34, anti-cd 30, anti-cyclin d1, anti-cd 15, anti-cd 5, fitc-conjugated rabbit, anti-human iga (alpha chain), fitc-conjugated rabbit, anti-human igg (gamma chain), fitc-conjugated rabbit, anti-human kappa light chain, fitc-conjugated rabbit, anti-human c3c complement, fitc-conjugated rabbit, anti-human igm (mu chain), fitc-conjugated rabbit, anti-human lambda (light chain), ana by hep-2-cell-line substrate(kit with reagents), electrodes for µph system 361, osmium tetroxide, chromium trioxide, zinc chloride, di-sodium hydrogen phosphate anhydrous, di-sodium hydrogen orthophosphate dibasic , sodium dihydrogen orthophosphate monohydrate, sodium borate, alpha napthyl butyrate, anti-cish kits-hpv16/18dna, er/p-r control, anti-melanomal(hmb45), anti myeloperoxidase, anti -nse, anti-plap, anti-bc12 oncoprotein, anti-cytokeratin7, anti-cytokeratin20, anti-brca 1protein, anti-iga, anti-igm, anti-igg, anti-compliment cd3, anti-rb gene protein, anti-p53 protein, anti-wt1 turmor, anti-vimentin (v9), anti-ema(e29), anti-p169ink4), kappa, lamda, eosine spirit soluble, pap pen immuno histochemistry, anti-cd 1a, anti-sma, anti-myogenin, fluorescent bchiff reagent, carmine, acriffarine, cresyl fast blue, luxol fast blue, cresyl violet, epinephrine (3x0.5ml), aggrecetion ristocetion a sulfate (3x0.5ml), a d p(adenosine-5l diphosphate(3x0.5ml), arachidonic acid lyohillzed sodium arachidonate, collagen soluble calfskin(3x0.5ml), vw fator assay ristocetin cofactor (3x0.5ml), test tube( siliconized,flate bottom 7x25x55mm), stri bars plastic coaled micro, cryo glue (tissue embedding medium)for cryostat machine, diposables blades for cryostat machine, silicon tubal ring , laser spectacles, fluid warmer, filter for suction machine( atmos), nibp monitor with integrated cuff arm , serum zinc, copper, ceruloplasmin, ammonia, ammonia, alcohol, d- dimer, anti ds dna, anti sn antibody, vitamin d, vitamin e, ngal, cystatin c, g6 pd, lactate, apo a1, homocysteine, bnp, urinary vma, blood ketones, lip a, ana, anti phospholipid antibody, vitamin c, ena, vitamin k, iodine, apo b, troponin t, ck mb1, ck mb 2, tibc, transferrin, igg, igm, iga, inhibin a, ß trace protein, ßeta 2 microgobulin, alpha 1 antitrypsin, a -1 microglobulin, a-2 macroglobulin, screening kit for inborn error of metabolism, eqas for clinical chemistry,immunoassay, electrolyte, hba1c., tpo (thyroperoxidase) antibody, control for m-band electrophoresis, tnf-a, il-2, procalcitonin, 5'acagcgtcatggcagagcaggtggc3’, 5'aaaagctcttcccgcaggatcccgc3’, 5'gtggctgttccgggatggccttctg3’, 5'cttgaagaagggctcactctgtttg3’, 5'cagtacgatgatgcagc3’, 5'caggtagaagaggcggt3’, amikacin ,neomycin &, tobramycin standard (hplc grade), edta gel (15%), acrylic - heat cure-clear, acrylic - heat cure-pink, acrylic - self cure-clear, acrylic - self cure-pink, agate spatula, alginate impression material ( dustless), articulation paper, bur - airotor-diamond, bur - airotor-tc- straight fissure, calcium hydroxide paste for root canal , dappen dish, dental floss – waxed, 25 m, dental stone, dentin bonding agent, die stone, disposable suction tips with copper wire, emery sheet - 100, 150 and 400 grade, endodontic gutta percha points(15-80), etchant gel ( 37 % phosphoric acid), fiber composite splint, flexible composite polishing discs, formocresol, gic- high strength pacakable for posteriors, glass ionomer cement type i, glass ionomer cement type ii, gluma dentin desensitizer, gutta percha sticks, halogen bulbs- 12v, 55 w , hydroxyapatite bone graft material, k file - all sizes, light cure composite - flowable - all shades, light cure composite - nano-hybrid – all shades, modelling wax sheet no.2, non eugenol impression paste - standard pack, pinnacle tracing sticks ( minimum three years shelf life), polishing brush for dental lathe, polymer reinforced zinc oxide eugenol cement , pumice powder for polishing dentures , silver reinforced glass ionomer, supernal base plate , tissue conditioner ( soft reliner), ultrasonic scaler tip, vacuum formed sheets - soft and hard - 2 and 3mm, vulcanite trimmer ( tc), zinc oxide eugenol impression paste, self cure acrylic tooth colour temporary crown materials (powder & liquid), cold - cure acrylic powder with liquid (white colour), pits and fissure sealant, zinc oxide eugenol impression paste , irm (intermediate restorative materials), gic fuji tupe ix, gic type -ii restoative materials, light cure composite nano- filling materials, alginate impression material ( dustless), dental stone, wedges, miracle mix materials , hand piece lubricant, dycal, suction tips, acrylic teeth set, polishing paste , polishing rubber cups and bristle, disposable glass, abrasive strips for polishing proximal areas of teeth, cellophene matrix strips for lc restoration, applicator tips for lc, desensitizing varnish, burs for tooth reduction set, dental stone cutting burs (small size), h-files for both anterior and posterior, k- file for both anterior and posterior , broaches, reamers for both anterior and posterior, gutta percha , absorbant paper point, titanium post (all sizes), protapper gutta parcha all size, alveogel, rc cal (intra canal dressing paste), fiber optics air rotor hand pieces with coupling unit, gp cutter, tungsten carbide burs for air rotor and micro motor handpieces, sectional matrixs, metal crown, zinc oxide powder and eugenol (big size), zinc oxide eugenol (powder ), zinc oxide eugenol (liquid), zinc oxide eugenol (ready mix), zno impression paste , dycal cement, stone burs (all sizes and shape), stone burs for polishing (fine), composit polishing disc, composite cement , composite filling kit, composite finishing and polishing , composite polishing disc, composite polishing kit, composite polishing paste , endo wash 5% 450ml, bristle brush & cup, eugenol 15ml, eugenol 110ml, dpi selfcure, ketac molar, nt premium, one coat bond, gic lc (mini) gc, pivo crown & bridge kit, protaper hand kit 21/25mm, mouth mith handle (gdc), explorer (gdc), surgical scissor (brp), dpi alloy, tri hawk, glyde 3mlx1, gp f4-f5 (dentsply), gp (15/35/40 ) dentsply, dtech etchn, h file 15/20/25, matrix band no1, diamond bur, shofu crown & bridge kit, vitrebond, ah 26, ketac silver, api needle holder, nsk
|